ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:98
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:14:00
Modification date:25-JAN-2005 14:59:19
 
Regulatory sequence name:gnrh exon 3
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000165704
AEdb ID:
Sequence:AAGAGATGGGCAAGGAGGTGGA
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:gonadotropin-releasing hormone premessenger ribonucleic acid
 
Citation line:Steingrimsdottir, H., G. Rowley, G. Dorado, J. Cole, and A. R. Lehmann. 1992. Mutations which alter splicing in the human hypoxanthine-guanine phosphoribosyltransferase gene. Nucleic Acids Res. 20:1201-1208.
PubMed ID:1373235
 
Comments:
(activated in workbench):Y
spacer

spacer