ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:89
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:21-SEP-2004 10:05:53
Modification date:21-SEP-2005 11:03:28
 
Regulatory sequence name:gaba-a, gamma-aminobutyric acid (gaba-a) receptor, intron 9
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Mus musculus, mouse
Binding factors:Nova-1
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_177408
Ensembl ID:ENSMUSG00000020436
AEdb ID:
Sequence:TCATTTTCAGATTCATCATCTCAT
Mutated regulatory sequence:
 
Methods:In vitro splicing assay
Mutagenesis
Nuclease protection
Keywords:exon 9,gaba-a,gamma-aminobutyric acid (gaba-a) receptor,nova,nise
 
Citation line:Dredge BK, Darnell RB. Nova regulates GABA(A) receptor gamma2 alternative splicing via a distal downstream UCAU-rich intronic splicing enhancer. Mol Cell Biol. 2003 Jul;23(13):4687-700.
PubMed ID:12808107
 
Comments:This study demonstrated that E9 splicing is regulated by Nova-1, and an intronic sequence that is necessary for Nova dependent enhancement of exon inclusion was identified.
(activated in workbench):Y
spacer

spacer