ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:84
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:20-SEP-2004 14:16:46
Modification date:19-SEP-2005 17:32:49
 
Regulatory sequence name:gag
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Rous Sarcoma virus
Binding factors:SF2/ASF
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:AGAAACCAGCAACGGAGCGGCGAAT
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
In vitro splicing assay
Gel mobility shift
Mutagenesis
UV cross-linking
Keywords:
 
Citation line:McNally, L.M. and McNally, M.T. (1996) SR protein splicing factors interact with the Rous sarcoma virus negative regulator of splicing element. J Virol, 70, 1163-1172. ; McNally, L.M. and McNally, M.T. (1998) An RNA splicing enhancer-like sequence is a component of a splicing inhibitor element from Rous sarcoma virus. Mol Cell Biol, 18, 3103-3111.
PubMed ID:8551577 , 9584151
 
Comments:
(activated in workbench):Y
spacer

spacer