ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:83
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:20-SEP-2004 14:15:21
Modification date:21-SEP-2005 14:42:46
 
Regulatory sequence name:gag
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Rous Sarcoma virus
Binding factors:HnRNP H
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:CGAATCGACAAAGGGGAGGAAGTGGGAGAAA
Mutated regulatory sequence:
 
Methods:Gel mobility shift
In vitro binding
UV cross-linking
Immunoprecipitation
Keywords:
 
Citation line:Fogel, B.L. and McNally, M.T. (2000) A Cellular Protein, hnRNP H, Binds to the Negative Regulator of Splicing Element from Rous Sarcoma Virus. J. Biol. Chem., M005000200.
PubMed ID:10934202
 
Comments:In the sequence GGGG and GGG are the binding sites of hnRNP H
(activated in workbench):Y
spacer

spacer