ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:82
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:20-SEP-2004 14:07:20
Modification date:21-SEP-2005 12:23:30
 
Regulatory sequence name:c/cgrp exon 4
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Rattus sp., rat
Binding factors:hTra2 beta
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:AGACCTCAACAAGTTTCACACC
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Tran, Q., T. P. Coleman, and J. R. Roesser. 2003. Human transformer 2beta and SRp55 interact with a calcitonin-specific splice enhancer. Biochim.Biophys.Acta 1625:141-152. van Oers CC, Adema GJ, Zandberg H, Moen TC, Baas PD. Two different sequence elements within exon 4 are necessary for calcitonin-specific splicing of the human calcitonin/calcitonin gene-related peptide I pre-mRNA. Mol Cell Biol. 1994 Feb;14(2):951-60.
PubMed ID:12531473 , 8289835
 
Comments:ESE A
(activated in workbench):Y
spacer

spacer