ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:74
Internal ref. ID:273a/2003
Submitter name:STEFANIE
Entry date:16-SEP-2004 16:08:08
Modification date:21-SEP-2005 10:37:56
 
Regulatory sequence name:ewg intron 6, au 4-6
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Drosophila melanogaster, fruit fly
Binding factors:ELAV
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_166836 , AF L11345
Ensembl ID:CG3114
AEdb ID:
Sequence:ATTTTTATTTTTAATTATTGTT
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
Gel mobility shift
Keywords:erect wing (ewg),alternative splicing,alternative polyadenylation,neuron-specific rna-binding protein,posttranscriptional regulation,elav-regulated genes
 
Citation line:Soller, M. and K. White (2003). "ELAV inhibits 3'-end processing to promote neural splicing of ewg pre-mRNA." Genes Dev 17(20): 2526-38.
PubMed ID:14522950
 
Comments:
(activated in workbench):Y
spacer

spacer