ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:69
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:15-SEP-2004 14:53:51
Modification date:19-SEP-2005 18:10:03
 
Regulatory sequence name:cd45 exon 4
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000081237
AEdb ID:
Sequence:GTGACCCCTTACCTACTCACACCACTGCATTCTCACCCGCAAGCACCTTTG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Lynch, K. W. and A. Weiss. 2001. A CD45 polymorphism associated with multiple sclerosis disrupts an exonic splicing silencer. J.Biol.Chem. 276:24341-24347.
PubMed ID:11306584
 
Comments:
(activated in workbench):Y
spacer

spacer