ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:64
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:15-SEP-2004 14:47:55
Modification date:24-JAN-2005 16:04:39
 
Regulatory sequence name:insulin receptor exon 11 upstream intron
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000171105
AEdb ID:
Sequence:TTACTCGGACACATGTGGCCTCCAAGTGTCAGAGCCCAGTGGT
Mutated regulatory sequence:
 
Methods:Deletion analysis
In vivo splicing assay
Keywords:
 
Citation line:Kosaki, A., Nelson, J. and Webster, N.J. (1998) Identification of intron and exon sequences involved in alternative splicing of insulin receptor pre-mRNA. J Biol Chem, 273, 10331-10337.
PubMed ID:9553088
 
Comments:
(activated in workbench):Y
spacer

spacer