ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:62
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:15-SEP-2004 14:45:31
Modification date:19-SEP-2005 18:50:14
 
Regulatory sequence name:clathrin light chain b exon en
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Rattus sp., rat
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSRNOG00000017506
AEdb ID:
Sequence:ACAAAGCGTTCTACCAGCAGCCAGATGCTG
Mutated regulatory sequence:
 
Methods:Gel mobility shift
Keywords:
 
Citation line:Stamm, S., Casper, D., Hanson, V. and Helfman, D.M. (1999) Regulation of the neuron-specific exon of clathrin light chain B. Mol. Brain Res., 64, 108-118.
PubMed ID:9889339
 
Comments:
(activated in workbench):Y
spacer

spacer