ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:61
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:15-SEP-2004 14:44:37
Modification date:19-SEP-2005 18:52:39
 
Regulatory sequence name:fibroblast growth factor receptor-2, exon bek
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Homo sapiens, human
Binding factors:PTB
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000066468
AEdb ID:
Sequence:TCTTTAGGTTCCCTTTCAATTCT
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Le Guiner, C., A. Plet, D. Galiana, M. C. Gesnel, F. Gatto-Konczak, and R. Breathnach. 2001. Polypyrimidine tract-binding protein represses splicing of a fibroblast growth factor receptor-2 gene alternative exon through exon sequences. J.Biol.Chem. 276:43677-43687.
PubMed ID:11557769
 
Comments:the given motif is contained in an artificial insert from chr9 into the BEK exon, the paper also describes silencer in the natural BEK but does not exactly characterize them
(activated in workbench):Y
spacer

spacer