ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:58
Internal ref. ID:
Submitter name:STEFANIE
Entry date:15-SEP-2004 14:42:07
Modification date:19-SEP-2005 15:06:38
 
Regulatory sequence name:mvm ns-specific exon
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Unknown
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:AGAGATCGAGGAGGATTTGAGAG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Gersappe, A. and D. J. Pintel. 1999. CA- and purine-rich elements form a novel bipartite exon enhancer which governs inclusion of the minute virus of mice NS2-specific exon in both singly and doubly spliced mRNAs. Mol.Cell Biol. 19:364-375.
PubMed ID:9858560
 
Comments:part of a bipartite exonic enhancer
(activated in workbench):Y
spacer

spacer