ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:55
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:15-SEP-2004 14:23:42
Modification date:20-SEP-2005 18:19:48
 
Regulatory sequence name:beta tropomyosin intron ivs ab
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Gallus gallus, chicken
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSGALG00000004015
AEdb ID:
Sequence:CCCTCTCTCTATCGCTGTCTCTTGAGCCACGCC
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
Mutagenesis
Keywords:
 
Citation line:Libri, D., Goux, P.M., Brody, E. and Fiszman, M.Y. (1990) Exon as well as intron sequences are cis-regulating elements for the mutually exclusive alternative splicing of the beta tropomyosin gene. Mol Cell Biol, 10, 5036-5046. ; Libri, D., Piseri, A. and Fiszman, M.Y. (1991) Tissue-specific splicing in vivo of the beta-tropomyosin gene: dependence on an RNA secondary structure. Science, 252, 1842-1845.
PubMed ID:2398885 , 2063196
 
Comments:
(activated in workbench):Y
spacer

spacer