ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:54
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:15-SEP-2004 14:22:13
Modification date:24-JAN-2005 08:28:56
 
Regulatory sequence name:caldesmon exon 5
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000122786
AEdb ID:
Sequence:GAGGAAGAGAAAAGGGCAGCAGAGGAGAGGCA
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
Keywords:
 
Citation line:Elrick, L.L., Humphrey, M.B., Cooper, T.A. and Berget, S.M. (1998) A short sequence within two purine-rich enhancers determines 5' splice site specificity. Mol. Cell. Biol., 18, 343-352.
PubMed ID:9418881
 
Comments:motif x 4
(activated in workbench):Y
spacer

spacer