ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:432
Internal ref. ID:
Submitter name:IDAN
Entry date:22-SEP-2005 08:33:19
 
Regulatory sequence name:pre, intron between exons 2 and 3
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Drosophila melanogaster, fruit fly
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:AF190403
Ensembl ID:CG17228
AEdb ID:
Sequence:AGAAACGAGACAGAGAGAGAGAGAGAGAGAGAGAGAGACGGGGAGAAAAG
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
Keywords:twintron
 
Citation line: Scamborova, P., A. Wong, and J.A. Steitz, An intronic enhancer regulates splicing of the twintron of Drosophila melanogaster prospero pre-mRNA by two different spliceosomes. Mol Cell Biol, 2004. 24(5): p. 1855-69.
PubMed ID:14966268
 
Comments:Motif enhances two isoforms, one of which is U2 and the second U12. mutated sequences:Ttacgtcgtgataccgtgcctaagaattcccgtgtttccgtgccta; Ttacgtcgtgataccgtgcctaagaattcccgtgtttcagaaacga; Ttacgtcgagacagagagagagagagagagagagagagacggggagaaaag; Gaagaagac;aggacagagc;
(activated in workbench):N
spacer

spacer