ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:41
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:15-SEP-2004 14:06:24
Modification date:30-JAN-2005 06:18:02
 
Regulatory sequence name:hiv-1 tat-rev exon 3
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Unknown
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:AGATCCATTCGATTAGTGAA
Mutated regulatory sequence:
 
Methods:In vitro binding
Spliceosomal complex formation
Keywords:
 
Citation line:Amendt, B.A., Si, Z.H. and Stoltzfus, C.M. (1995) Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors. Mol. Cell. Biol., 15, 6480.
PubMed ID:7565800
 
Comments:
(activated in workbench):Y
spacer

spacer