ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:373
Internal ref. ID:357-2004d
Submitter name:SHAOQING HUANG
Entry date:08-SEP-2005 20:54:36
 
Regulatory sequence name:cftr, intron 8
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_000492
Ensembl ID:ENSG00000001626
AEdb ID:
Sequence:TTTTGATGTGTGTGTGTGTGTGTGTGTGTGTTTTTTTAACAG
Mutated regulatory sequence:
 
Methods:Mutagenesis
Keywords:polymorphism,cftr,mutation,cbavd,polyvariant,(tg)12-t7
 
Citation line:Cuppens H, Cassiman JJ. CFTR mutations and polymorphisms in male infertility. Int J Androl. 2004 Oct;27(5):251-6. Review.
PubMed ID:15379964
 
Comments:1. A less efficient splicing will occur when a lower number of thymidines are found, the higher the number of TG repeats, the less efficient exon 9 splicing will occur. 2. TGm/Tn haplotype sequences at the end of intron 8 of the CFTR gene.
(activated in workbench):N
spacer

spacer