ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:37
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:15-SEP-2004 13:51:41
Modification date:20-SEP-2005 14:38:02
 
Regulatory sequence name:hiv-1 tat exon 2
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Unknown
Binding factors:ASF/SF2
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:GAAGAAGCGGAGACAGCGACG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Kammler, S., C. Leurs, M. Freund, J. Krummheuer, K. Seidel, T. O. Tange, M. K. Lund, J. Kjems, A. Scheid, and H. Schaal. 2001. The sequence complementarity between HIV-1 5' splice site SD4 and U1 snRNA determines the steady-state level of an unstable env pre-mRNA. RNA. 7:421-434.
PubMed ID:11333022
 
Comments:ESE2
(activated in workbench):Y
spacer

spacer