ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:35
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:13-SEP-2004 15:39:37
Modification date:19-SEP-2005 18:25:18
 
Regulatory sequence name:a-tropomyosin gene exon 5/sk
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000143549
AEdb ID:
Sequence:TAAGTGTTCTGAGCTGGAGGAGGAGCTGAAGAATGTCACCAACAACCTCAAGTCTCTTGAGGCTCAGGCGGAGAAG
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
Nuclease protection
Keywords:
 
Citation line:Graham, I.R., Hamshere, M. and Eperon, I.C. (1992) Alternative splicing of a human alpha-tropomyosin muscle-specific exon: identification of determining sequences. Mol. Cell. Biol., 12, 3872-3882.
PubMed ID:1508190
 
Comments:
(activated in workbench):Y
spacer

spacer