ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:32
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:13-SEP-2004 15:35:10
Modification date:27-SEP-2004 13:23:30
 
Regulatory sequence name:c-src intron b downstream of exon n1
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Mus musculus, mouse
Binding factors:KSRP, p53/hnRNP F
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSMUSG00000027646
AEdb ID:
Sequence:AGGCTGGGGGCTGCTCTCTGCATGTGCTTCCT
Mutated regulatory sequence:
 
Methods:In vitro splicing assay
Gel mobility shift
In vitro binding
UV cross-linking
Keywords:
 
Citation line:Min, H., Turck, C.W., Nikolic, J.M. and Black, D.L. (1997) A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes and Dev., 11, 1023-1036.
PubMed ID:9136930
 
Comments:
(activated in workbench):Y
spacer

spacer