ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:291
Internal ref. ID:
Submitter name: YESHENG TANG
Entry date:26-JAN-2005 15:46:47
Modification date:26-JAN-2005 15:51:04
 
Regulatory sequence name:bgh, exon5
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Bos taurus, bovine
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:TCTCCTGCTTCCGGAAGGAC
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Tanaka, K., Watakabe, A. and Shimura, Y. (1994) Polypurine sequences within a downstream exon function as a splicing enhancer. Mol. Cell. Biol., 14, 13471354.
PubMed ID:8289812
 
Comments:
(activated in workbench):Y
spacer

spacer