ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:25
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:13-SEP-2004 15:24:58
Modification date:20-SEP-2005 14:27:21
 
Regulatory sequence name:calcitonin (ct) exon 4
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000110680
AEdb ID:
Sequence:CACCTGGAAAGAAAAGGGATATGTCCAGCG
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
Mutagenesis
Keywords:
 
Citation line:Zandberg, H., Moen, T.C. and Baas, P.D. (1995) Cooperation of 5' and 3' processing sites as well as intron and exon sequences in calcitonin exon recognition. Nucleic Acids Res, 23, 248-255. an Oers CC, Adema GJ, Zandberg H, Moen TC, Baas PD. Two different sequence elements within exon 4 are necessary for calcitonin-specific splicing of the human calcitonin/calcitonin gene-related peptide I pre-mRNA.Mol Cell Biol. 1994 Feb;14(2):951-60.
PubMed ID:7862529 , 8289835
 
Comments:the given motif is a putative purine-rich core element
(activated in workbench):Y
spacer

spacer