ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:233
Internal ref. ID:1183b
Submitter name:DARYA
Entry date:01-OCT-2004 16:23:30
 
Regulatory sequence name:mypt1 , intron 5
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_205123
Ensembl ID:ENSGALG00000010325
AEdb ID:
Sequence:AAAGTAATACCTCCTATTTATTTCCCTGGAAACTACAGCAGTTACAAAGAGCACAATAACACTATTT
Mutated regulatory sequence:
 
Methods:Deletion analysis
Mutagenesis
Keywords:apoptosis,intron 5,chick embryo,gene silencing,smooth muscle,recombinant fusion proteins,myosin-light-chain phosphatase,mypt1
 
Citation line:Dirksen, W. P., S. A. Mohamed, et al. (2003). "Splicing of a myosin phosphatase targeting subunit 1 alternative exon is regulated by intronic cis-elements and a novel bipartite exonic enhancer/silencer element." J Biol Chem 278(11): 9722-32.
PubMed ID:12509424
 
Comments:this ISE was identified in the intron ~190 nucleotides downstream of the alternative exon.
(activated in workbench):Y
spacer

spacer