ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:222
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 19:41:30
Modification date:21-SEP-2005 10:13:00
 
Regulatory sequence name:beta-tropomyosin, exon 6/7
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Rattus sp., rat
Binding factors:PTB, Sam68, FBP
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSRNOG00000016731
AEdb ID:
Sequence:AACCCCACCCCCTCACCCCGTGCTCGCGCCACCCCACTGTCTCACCTCACTGTGCCCTCACGCTCCATCCTGCCACACGCCCCTGCAG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Mulligan, G, Guo, W, Wormsley, S and Helfman, D: Polypyrimidine tract binding protein interacts with sequences involved in alternative splicing of b-tropomyosin. J Biol Chem 1992, 267:25480-25487.Grossman, J, Meyer, M, Wang, Y, Mulligan, G, Kobayashi, R and Helfman, D: The use of antibodies to the polypyrimidine tract binding protein (PTB) to analyze the protein components that assemble on alternatively spliced pre-mRNAs that use distant branch points. RNA 1998, 4:613-625.
PubMed ID:1460042 , 9622121
 
Comments:Location of element-upstream of exon 7 (-88 to -1)
(activated in workbench):Y
spacer

spacer