ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:221
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 19:37:19
Modification date:20-SEP-2005 15:56:47
 
Regulatory sequence name:beta-tropomyosin, exon 6a/6b
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Gallus gallus, chicken
Binding factors:TLS
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_205446
Ensembl ID:ENSGALG00000002563
AEdb ID:
Sequence:GCTGGGGCTGGGCAGAGCGCGCAGGGTTGAGGGGAGCAGGGTCCTTCACTGGGGTGAA
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Sirand-Pugnet, P, Durosay, P, Brody, E and Marie, J: An intronic (A/U)GGG repeat enhances the splicing of an alternative intron of the chicken beta-tropomyosin pre-mRNA. Nuc Acids Res 1995, 23:3501-3507.Lerga, A, Hallier, M, Delva, L, Orvain, C, Gallais, I, Marie, J and Moreau-Gachelin, F: Identification of an RNA binding specificity for the potential splicing factor TLS. J Biol Chem 2001, 276:6807-6816.
PubMed ID:7567462 , 11098054
 
Comments:Location of element-downstream of exon 6B (+19 to 76)
(activated in workbench):Y
spacer

spacer