ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:220
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 19:34:42
Modification date:20-SEP-2005 15:55:42
 
Regulatory sequence name:beta-tropomyosin, exon 6a/6b
Entry type:Intron enhancer
Sequence origin:Exonic
Organism:Gallus gallus, chicken
Binding factors:ASF/SF2, SC35, PTB, hnRNP K
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_205446
Ensembl ID:ENSGALG00000002563
AEdb ID:
Sequence:CCCCTCTCTCTATCGCTGTCTCTTGAGCCACGC
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Gallego, M, Balvay, L and Brody, E: cis-acting sequences involved in exon selection in the chicken beta-tropomyosin gene. Mol Cell Biol 1992, 12:5415-5425.Balvay, L, Libri, D, Gallego, M and Fiszman, M: Intronic sequence with both negative and positive effects on the regulation of alternative transcripts of the chicken beta tropomyosin transcripts. Nuc Acids Res 1992, 20:3987-3992.Gallego, M, Gattoni, R, StÚvenin, J, Marie, J and Expert-Bezanšon, A: The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the b-tropomyosin alternative exon 6A. EMBO J 1997, 16:1772-1784.Expert-Bezanšon, A, Le Caer, J and Marie, J: Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a component of an intronic splicing enhancer complex that activates the splicing of the alternative exon 6A from chicken b-tropomyosin pre-mRNA. J Biol Chem 2002, 277:16614-16623.
PubMed ID:1280322 , 1508684 , 9130721 , 11867641
 
Comments:Location of element-downstream of exon 6A (+37 to 69)
(activated in workbench):Y
spacer

spacer