ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:22
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:13-SEP-2004 15:03:47
Modification date:20-SEP-2005 14:03:23
 
Regulatory sequence name:dystrophin exon27
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000198947
AEdb ID:
Sequence:TAAAGAAGAGGCCCAACAAAAAGAAGCGAAAG
Mutated regulatory sequence:
 
Methods:In vitro splicing assay
Mutagenesis
Keywords:
 
Citation line:Shiga, N., Takeshima, Y., Sakamoto, H., Inoue, K., Yokota, Y., Yokoyama, M. and Matsuo, M. (1997) Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy. J. Clin. Invest., 100, 2204-2210.
PubMed ID:9410897
 
Comments:
(activated in workbench):Y
spacer

spacer