ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:213
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 19:07:27
 
Regulatory sequence name:tat, intron 2
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Unknown
Binding factors:hnRNP A1
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:TAGTGAATAGAGTTAGGCAGGGA
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Tange, T, Damgaard, C, Guth, S, Valcárcel, J and Kjems, J: The hnRNP A1 protein regulates HIV-1 tat splicing via a novel intron silencer element. EMBO J 2001, 20:5748-5758.
PubMed ID:11598017
 
Comments:Location of element-upstream of SA7 splice site (-44 to -22)
(activated in workbench):Y
spacer

spacer