ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:210
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 18:55:35
Modification date:20-SEP-2005 12:50:07
 
Regulatory sequence name:nova-1, exon h
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Mus musculus, mouse
Binding factors:Nova-1
 
EMBL/Genbank/DDBJ/RefSeq Accession number:XM_356586
Ensembl ID:ENSMUSG00000021047
AEdb ID:
Sequence:TCATCCTCTCATCTACACCAT
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Buckanovich, R and Darnell, R: The neuronal RNA binding protein Nova-1 recognizes specific RNA targets in vitro and in vivo. Mol Cell Biol 1997, 17:3194-201.
PubMed ID:9154818
 
Comments:Location of element- downstream (+8 to 62)
(activated in workbench):Y
spacer

spacer