ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:208
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 18:46:56
 
Regulatory sequence name:nmda, exon 5
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Rattus sp., rat
Binding factors:PTB, CUG-BP
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:GCTTTAGCGCCGTCATTTTCAACCGTTTATAATCTTCTTCTGTGTCTGCATATTTTCTCTGTGCACATTATTCATCAG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Zhang, L, Liu, W and Grabowski, P: Coordinate repression of a trio of neuron-specific splicing events by the splicing regulator PTB. RNA 1999, 5:117-30.
PubMed ID:9917071
 
Comments:Location of element-upstream (-78 to -1)
(activated in workbench):Y
spacer

spacer