ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:207
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 18:42:42
Modification date:19-SEP-2005 17:13:59
 
Regulatory sequence name:ncam, msdb exon
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Mus musculus, mouse
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_010875 , AB001873
Ensembl ID:
AEdb ID:
Sequence:GACCTCACTGACCCAGCTGGGCCTTTGTCACATTGGGGGAGCCTGGTTCTTTCCTCTCATTCTCTTAACTGTCTATACTTTAGTTCTTTGAATCTGGAGGAGTGGAACAGGTCCACTCTTTGGAAACTTGAACCTGGCTTTCTAGT
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Kawahigashi, H, Harada, Y, Asano, A and Nakamura, M: A cis-acting regulatory element that affects the alternative splicing of a muscle-specific exon in the mouse NCAM gene. Biochem Biophys Acta 1998, 1397:305-315.
PubMed ID:9582442
 
Comments:Location of element-downstream (+626 to 771)
(activated in workbench):Y
spacer

spacer