ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:197
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 18:24:30
 
Regulatory sequence name:major late region 1 (l1) 52,55k/iiia
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Adenovirus family
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:AGTACTAAGCGGTGATGTTTCTGATCAG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Mühlemann, O, Yue, B-G, Petersen-Mahrt, X and Akusjärvi, G: A novel type of splicing enhancer regulating adenovirus pre-mRNA splicing. Mol Cell Biol 2000, 20:2317-2325.
PubMed ID:10713155
 
Comments:Location of element-upstream of IIIa splice site (-28 to -1)
(activated in workbench):Y
spacer

spacer