ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:195
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 18:21:59
 
Regulatory sequence name:major late region 1 (l1) 52,55k/iiia
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Adenovirus family
Binding factors:SR proteins
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:GCGTGGAGGAATATGACGAGGACGATGAGTACGAGCCAGAGGACGGCGA
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Kanopka, A, Mühlemann, O and Akusjärvi, G: Inhibition by SR proteins of splicing of a regulated adenovirus pre-mRNA. Nature 1996, 381:535-538.
PubMed ID:8632829
 
Comments:Location of element-upstream of IIIa splice site (-76 to -28)
(activated in workbench):Y
spacer

spacer