ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:192
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 18:14:23
Modification date:27-SEP-2004 18:14:58
 
Regulatory sequence name:hnrnp a1, exon 7b
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Mus musculus, mouse
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:U65316
Ensembl ID:
AEdb ID:
Sequence:CCTGCTCTGCTGTGCTACCTCCTCCTGGCTTTAAGCTGGGGCCGCCTCCCCAAAATAAGTAGGTGAATGAGTGGTTA
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Blanchette, M and Chabot, B: A highly stable duplex structure sequesters the 5' splice site region of hnRNP A1 alternative exon 7B. RNA 1997, 3:405-419.
PubMed ID:9085847
 
Comments:Location of element-downstream (+128 to 204)
(activated in workbench):Y
spacer

spacer