ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:191
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 18:10:56
Modification date:21-SEP-2005 14:47:12
 
Regulatory sequence name:hnrnp a1, exon 7b
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Mus musculus, mouse
Binding factors:hnRNP A1
 
EMBL/Genbank/DDBJ/RefSeq Accession number:U65316
Ensembl ID:ENSMUSG00000036021
AEdb ID:
Sequence:AGCTAGATTAGACTTCTAGAGTTT
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Chabot, B, Blanchette, M, Lapierre, I and La Branche, H: An intron element modulating 5' splice site selection in the hnRNP A1 pre-mRNA interacts with hnRNP A1. Mol Cell Biol 1997, 17:1776-1786.Blanchette, M and Chabot, B: Modulation of exon skipping by high-affinity hnRNP A1-binding sites and by intron elements that repress splice site utilization. EMBO J 1999, 18:1939-1952.
PubMed ID:9121425 , 10202157
 
Comments:Location of element-downstream (+35 to 58)
(activated in workbench):Y
spacer

spacer