ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:188
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 17:56:28
 
Regulatory sequence name:gag gene
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Rous Sarcoma virus
Binding factors:hnRNP H, SF2/ASF
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:CCGGAGTGCTCGAGAAACCAGCAACGGAGCGGCGAATCGACAAAGGGGAGGAAGTGGGAGAAACAACTGTGCAGCGAGATGCGAAGATGGCGCCGGAGGAAACGGCCACACCTAAAACCGTTGGCACATCCTGCTATCATTGCGGAACAGCTATTGGCTGTAATTGCGCCACAGCCTCGGCTCCCTCCTCCTCCTTATGTGGGGAGTGGTTTGTATCCTTCCCT
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Fogel, B and McNally, M: A cellular protein, hnRNP H, binds to the negative regulator of splicing element from Rous sarcoma virus. J Biol Chem 2000, 275:32371-32378.McNally, M, Gontarek, R and Beemon, K: Characterization of Rous sarcoma virus intronic sequences that negatively regulate splicing. Virology 1991, 185:99-108.McNally, L and McNally, M: SR protein splicing factors interact with the Rous sarcoma virus negative regulator of splicing element. J Virol 1996, 70:1163-1172.
PubMed ID:10934202 , 8551577 , 1656608
 
Comments:Location of element-downstream of 5' splice site (~300nt)
(activated in workbench):Y
spacer

spacer