ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:177
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 17:19:36
Modification date:21-SEP-2005 14:12:03
 
Regulatory sequence name:fibroblast growth factor receptor 2 , exons bek/k-sam (iiib/iiic) exons
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000066468
AEdb ID:
Sequence:CCATGGAAAAATGCCCACAAC
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:del Gatto, F, Plet, A, Gesnel, M-C, Fort, C and Breathnach, R: Multiple interdependent sequence elements control splicing of a fibroblast growth factor receptor 2 alternative exon. Mol Cell Biol 1997, 17:5106-5116.
PubMed ID:9271388
 
Comments:Location of element-downstream of K-SAM (+168 to 188); motif is part of a stem-loop structure
(activated in workbench):Y
spacer

spacer