ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:176
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 17:17:13
 
Regulatory sequence name:fibroblast growth factor receptor 2 , exons bek/k-sam (iiib/iiic) exons
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000066468
AEdb ID:
Sequence:CTTTCATTTTTGTCTTTTTTT
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:del Gatto, F and Breathnach, R: Exon and intron sequences, respectively, repress and activate splicing of a fibroblast growth factor receptor 2 alternative exon. Mol Cell Biol 1995, 15:4825-4834.del Gatto-Konczak, F, Bourgeois, C, Le Gunier, C, Kister, L, Gesnel, M-C, StÚvenin, J and Breathnach, R: The RNA-binding protein TIA-1 is a novel mammalian splicing regulator acting through intron sequences adjacent to a 5' splice site. Mol Cell Biol 2000, 20:6287-6299.
PubMed ID:7651400 , 10938105
 
Comments:Location of element-downstream of K-SAM (+10 to 29)
(activated in workbench):Y
spacer

spacer