ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:175
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 17:12:50
Modification date:21-SEP-2005 14:10:56
 
Regulatory sequence name:fibroblast growth factor receptor 1, exon alpha
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000077782
AEdb ID:
Sequence:ATCTGCCCCCACTCTGCTTCAGAAACTGCTGCCCACTAACATTGCTCCCTGCCTGCCGCGTG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Jin, W, Bi, W, Huang, ES-C and Cote, G: Glioblastoma cell-specific expression of fibroblast growth factor receptor-1b requires an intronic repressor of RNA splicing. Cancer Res 1999, 59:316-319.
PubMed ID:9927039
 
Comments:Location of element-downstream (+98 to 159)
(activated in workbench):Y
spacer

spacer