ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:174
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 17:09:03
 
Regulatory sequence name:fibroblast growth factor receptor 1, exon alpha
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:PTB
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000077782
AEdb ID:
Sequence:AATGCTGCTACAGCTGCTTCCTAACTTTGCCTCTTTCTTC
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Jin, W, Huang, ES-C, Bi, W and Cote, G: Redundant intronic repressors function to inhibit fibroblast growth factor receptor-1 a-exon recognition in glioblastoma cells. J Biol Chem 1999, 274:28035-28041.Jin, W, McCutcheon, I, Fuller, G, Huang, ES-C and Cote, G: Fibroblast growth factor receptor-1 a-exon exclusion and polypyrimidine tract-binding protein in glioblastoma mutiforme tumors. Cancer Res 2000, 60:1221-1224.
PubMed ID:10488155 , 10728679
 
Comments:Location of element-upstream (-242 to -281)
(activated in workbench):Y
spacer

spacer