ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:166
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 16:22:58
Modification date:21-SEP-2005 13:12:47
 
Regulatory sequence name:caspase-2, exon 9
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Mus musculus, mouse
Binding factors:U2 snRNP
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_007610
Ensembl ID:ENSMUSG00000029863
AEdb ID:
Sequence:GCTTATTAACTGCAATGTACTTTTTATTGTTTTTCATTCCAGTTAAGG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Côté, J, Dupuis, S, Jiang, Z-H and Wu, J: Caspase-2 pre-mRNA alternative splicing: identification of an intronic element containing a decoy 3' acceptor site. Proc Natl Acad Sci 2001, 98:938-943. Côté, J, Dupuis, S and Wu, J: Polypyrimidine track-binding protein binding downstream of caspase-2 alternative exon 9 represses its inclusion. J Biol Chem 2001, 276:8535-8543
PubMed ID:11158574 , 11116151
 
Comments:Location of element-downstream (+141 to 188)
(activated in workbench):Y
spacer

spacer