ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:162
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 14:19:52
 
Regulatory sequence name:cardiac troponin t, exon 5
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Gallus gallus, chicken
Binding factors:PTB, ETR-3
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_205449
Ensembl ID:ENSGALG00000000302
AEdb ID:
Sequence:ACTGCACCTTTCTTTGTTCCATCTCTCCACCTCTGCTGTG
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Charlet-B., N, Logan, P, Singh, G and Cooper, T: Dynamic antagonism between ETR-3 and PTB regulates cell type-specific alternative splicing. Mol Cell 2002, 9:649-658.Cooper, T: Muscle-specific splicing of a heterologous exon mediated by a single muscle-specific splicing enhancer from the cardiac troponin T gene. Mol Cell Biol 1998, 18:4519-4525.
PubMed ID:9671461 , 11931771
 
Comments:Location of element-downstream (+7 to +46)
(activated in workbench):Y
spacer

spacer