ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:160
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 14:01:45
 
Regulatory sequence name:calcitonin/ cgrp, exon 4
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:PTB*, ASF/SF2*,
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_001741
Ensembl ID:ENSG00000110680
AEdb ID:
Sequence:CTCCGCTCCTCTTCCAGGTAAGAC
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Lou, H, Yang, Y, Cote, G, Berget, S and Gagel, R: An intron enhancer containing a 5' splice site sequence in the human calcitonin/calcitonin gene-related peptide gene. Mol Cell Biol 1995, 15:7135-7142.Lou, H, Gagel, R and Berget, S: An intron enhancer recognized by splicing factors activates polyadenylation. Genes Dev 1996, 1:208-219.Lou, H, Neugebauer, K, Gagel, R and Berget, S: Regulation of alternative polyadenylation by U1 snRNPs and SRp20. Mol Cell Biol 1998, 18:4977-4985.
PubMed ID:8524281 , 8566754 , 9710581
 
Comments:Location of element- downstream (+204 to 238)
(activated in workbench):Y
spacer

spacer