ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:159
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 13:56:44
Modification date:21-SEP-2005 11:06:22
 
Regulatory sequence name:cardiac troponin t, intron 2
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Gallus gallus, chicken
Binding factors:PTB*, U2AF65
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_205449
Ensembl ID:ENSGALG00000000302
AEdb ID:
Sequence:CCTCTGCGCTTCTTCCCTTCCCTCCTCCCTGGCTCA
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Ryan, K and Cooper, T: Muscle-specific splicing enhancers regulate inclusion of the cardiac troponin T alternative exon in embryonic skeletal muscle. Mol Cell Biol 1996, 16:4014-4023.Charlet-B., N, Logan, P, Singh, G and Cooper, T: Dynamic antagonism between ETR-3 and PTB regulates cell type-specific alternative splicing. Mol Cell 2002, 9:649-658.
PubMed ID:8754799 , 11931771
 
Comments:Location of element- upstream (-36 to -1)
(activated in workbench):Y
spacer

spacer