ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:158
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 13:37:47
 
Regulatory sequence name:calcitonin/ cgrp, exon 4
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Rattus sp., rat
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_017338
Ensembl ID:ENSRNOG00000011130
AEdb ID:
Sequence:CAGCCCTGGTGCATGGCACTGCCTC
Mutated regulatory sequence:
 
Methods:Gel mobility shift
Mutagenesis
Keywords:
 
Citation line:Hedjran, F, Yeakley, J, Huh, G, Hynes, R and Rosenfeld, M: Control of alternative pre-mRNA splicing by distributed pentameric repeats. Proc Natl Acad Sci 1997, 94:12343-12347.
PubMed ID:9356451
 
Comments:Location of element-upstream (-34 to -10)
(activated in workbench):Y
spacer

spacer