ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:153
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 13:05:51
 
Regulatory sequence name:amp deaminase 1 exon 2
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_000036
Ensembl ID:ENSG00000116748
AEdb ID:
Sequence:GCCCAGGCTGGAGTGCAGTA
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Genetta, T, Morisaki, H, Morisaki, T and Holmes, E: A novel bipartite intronic splicing enhancer promotes the inclusion of a mini-exon in the AMP deaminase 1 gene. J Biol Chem 2001, 276:25589-25597
PubMed ID:11331279
 
Comments:Location of element-downstream (~ +1.7 kb)
(activated in workbench):Y
spacer

spacer