ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:15
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:13-SEP-2004 14:51:18
Modification date:28-JAN-2005 08:41:21
 
Regulatory sequence name:ctnt intron 4
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Gallus gallus, chicken
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:GCGCTTCTTCCCTTCCCTCCTCCCTGGCTCAG
Mutated regulatory sequence:
 
Methods:In vivo splicing assay
Mutagenesis
Keywords:
 
Citation line:Cooper, T.A. (1998) Muscle-specific splicing of a heterologous exon mediated by a single muscle-specific splicing enhancer from the cardiac troponin T gene. Mol. Cell. Biol., 18, 4519-4525. ; Ryan KJ, Cooper TA.Muscle-specific splicing enhancers regulate inclusion of the cardiac troponin T alternative exon in embryonic skeletal muscle. Mol Cell Biol. 1996 Aug;16(8):4014-23.
PubMed ID:9671461 , 8754799
 
Comments:
(activated in workbench):Y
spacer

spacer