ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:149
Internal ref. ID:
Submitter name:DARYA, STEFAN
Entry date:27-SEP-2004 11:27:54
Modification date:21-SEP-2005 10:42:06
 
Regulatory sequence name:4.1r exon 16
Entry type:Intron enhancer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:ENSG00000159023
AEdb ID:
Sequence:TGTATGAACTTGAAGCTTATTTCAGTTGGTTGCCTGGAACCTTCTGCATTCTTTGCTGATCCCCTTTTCTTCATTCTGTGCTGCATTTGGTTTTGCATGCAATTGCATGAAGGGACTTTAGGTTTAAAATGCTTTTGCATGTT
Mutated regulatory sequence:
 
Methods:Unknown
Keywords:
 
Citation line:Deguillien, M, Huang, S-C, Moriniére, M, Dreumont, N, Benz, E, Jr. and Baklouti, F: Multiple cis elements regulate an alternative splicing event at 4.1R pre-mRNA during erythroid differentiation. Blood 2001, 98:3809-3816.
PubMed ID:11739190
 
Comments:Location of element-downstream (+4 to 146)
(activated in workbench):Y
spacer

spacer