ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:147
Internal ref. ID:1254-3
Submitter name:YILEI LIU
Entry date:24-SEP-2004 14:56:32
 
Regulatory sequence name:cftr:cystic fibrosis transmembrane receptor, intron 9
Entry type:Intron silencer
Sequence origin:Intronic
Organism:Homo sapiens, human
Binding factors:SF2/ASF, SC35, SRp75
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_000492
Ensembl ID:ENSG00000001626
AEdb ID:
Sequence:AATGTATGGGTGTAGTGTCTTGTATAATAGAAATTGTTCCACTGATAATTTACTCTAGTTTTTTATTTCCTCATATTATTTTCAGTGGCTTTTTCTTCCACATCTTTATATTTTGCACCACATTCAACACTGTATCTTGCACATGGCG
Mutated regulatory sequence:
 
Methods:UV cross-linking
Keywords:cftr,rna polymerase ii,cystic fibrosis transmembrane receptor,minigene,sf2/asf,fibronectin extra domain,edb,iss,ese,ess
 
Citation line:Pagani, F., C. Stuani, et al. (2003). "Promoter architecture modulates CFTR exon 9 skipping." J Biol Chem 278(3): 1511-7. Pagani F, Buratti E, Stuani C, Romano M, Zuccato E, Niksic M, Giglio L, Faraguna D, Baralle FE. “Splicing factors induce cystic fibrosis transmembrane regulator exon 9 skipping through a nonevolutionary conserved intronic element.” J Biol Chem. 2000 Jul 14;275(28):21041-7.
PubMed ID:12421814 , 10766763
 
Comments:
(activated in workbench):Y
spacer

spacer