ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:138
Internal ref. ID:412b
Submitter name:CAROLINE JOHNSTON
Entry date:23-SEP-2004 12:58:13
 
Regulatory sequence name:brca1 exon 5
Entry type:Exon enhancer
Sequence origin:Exonic
Organism:Homo sapiens, human
Binding factors:SRp55
 
EMBL/Genbank/DDBJ/RefSeq Accession number:NM_007304
Ensembl ID:ENSG00000012048
AEdb ID:
Sequence:TTTTGCATGCTGAAACTTCTCAACCAGAAGAAAGGGCCTTCACAGTGTCCTTTATGTAAGAATGATATAACCAAAAG
Mutated regulatory sequence:
 
Methods:Gel mobility shift
Mutagenesis
Natural ocurring mutant
Keywords:brca1,breast cancer,srp55
 
Citation line:Yand, Y., et al. “Aberrant splicing induced by missense mutations in BRCA1: clues from a humanized mouse model.” Hum. Mol. Genet. 12 (17) : 2121-2131
PubMed ID:12915465
 
Comments:Mutation of this enhancer sequence results in silencing of the constitutive 5' splice site of exon 5. The same mutation also creates a cryptic 5' splice site upstream of the constitutive site. This new site has better complimentarity to U1snRNA than the constitutive site. When used, this alternative site results in a frameshift that introduces a premature stop codon in exon 6.
(activated in workbench):Y
spacer

spacer