ASD - ALTERNATIVE SPLICING


View Record


FIELD NAME
FIELD VALUE
  
AEdbMotif ID:13
Internal ref. ID:
Submitter name:MAREK, STEFAN
Entry date:13-SEP-2004 14:39:04
Modification date:20-SEP-2005 13:42:26
 
Regulatory sequence name:igm exon m2
Entry type:Exon silencer
Sequence origin:Exonic
Organism:Mus musculus, mouse
Binding factors:
 
EMBL/Genbank/DDBJ/RefSeq Accession number:
Ensembl ID:
AEdb ID:
Sequence:CTAGTAAACTTATTCTTACGTCTTTCCTGTGTTGCCCTCCAGCTTTTATCTCTGAGATGGTCTTCTTTCTAGA
Mutated regulatory sequence:
 
Methods:Mutagenesis
Keywords:
 
Citation line:Tanaka, K., Watakabe, A. and Shimura, Y. (1994) Polypurine sequences within a downstream exon function as a splicing enhancer. Mol. Cell. Biol., 14, 13471354.
PubMed ID:8289812
 
Comments:
(activated in workbench):Y
spacer

spacer